SubtiBank SubtiBank
yabJ [2019-04-04 14:48:42]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yabJ [2019-04-04 14:48:42]

2-iminobutanoate/2-iminopropanoate deaminase, detoxification of reactive intermediates generated in isoleucine biosynthesis
13.51 kDa
protein length
125 aa Sequence Blast
gene length
378 bp Sequence Blast
deamination of reactive intermediates generated in isoleucine biosynthesis
2-iminobutanoate/2-iminopropanoate deaminase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • Gene

    55,295 55,672

    The protein

    Catalyzed reaction/ biological activity

  • release of ammonia from reactive enamine/imine intermediates of the pyridoxal 5'-phosphate-dependent threonine dehydratase ([protein|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|IlvA]) [pubmed|22094463]
  • 2-iminobutanoate + H2O = 2-oxobutanoate + NH3 [pubmed|22094463]
  • 2-iminopropanoate + H2O = pyruvate + NH3 [pubmed|22094463]
  • Protein family

  • Ref.3 (according to Swiss-Prot) YjgF family
  • Structure

  • [PDB|1QD9] [ NCBI] [Pubmed|10557275]
  • [PDB|5Y6U]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • was originally thought to be required for activity of [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR], but this is due to the orientation of the marker gene downstream of [gene|search|purR ]in the [gene|search|yabJ ]mutant strain used in [pubmed|10368157]
  • Expression and Regulation



    regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, [Pubmed|7638212], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • negative autoregulation [Pubmed|7638212]
  • view in new tab

    Biological materials


  • MGNA-B911 (yabJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00480 ([gene|285D9E676B06119F9F4D33FC62615EC844D35BC3|yabJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGTTTTGTGTGGACTGCTT, downstream forward: _UP4_TAATAAGAAAAGTGATTCTG
  • BKK00480 ([gene|285D9E676B06119F9F4D33FC62615EC844D35BC3|yabJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGTTTTGTGTGGACTGCTT, downstream forward: _UP4_TAATAAGAAAAGTGATTCTG
  • References

  • 10368157,7638212,7638212,10557275,22094463