SubtiBank SubtiBank
yabJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yabJ

2-iminobutanoate/2-iminopropanoate deaminase, detoxification of reactive intermediates generated in isoleucine biosynthesis
locus
BSU00480
pI
5.13
mw
13.51 kDa
protein length
125 aa Sequence Blast
gene length
378 bp Sequence Blast
function
deamination of reactive intermediates generated in isoleucine biosynthesis
product
2-iminobutanoate/2-iminopropanoate deaminase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.12|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • Gene

    Coordinates
    55,295 55,672

    The protein

    Catalyzed reaction/ biological activity

  • release of ammonia from reactive enamine/imine intermediates of the pyridoxal 5'-phosphate-dependent threonine dehydratase ([protein|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|IlvA]) [pubmed|22094463]
  • 2-iminobutanoate + H2O = 2-oxobutanoate + NH3 [pubmed|22094463]
  • 2-iminopropanoate + H2O = pyruvate + NH3 [pubmed|22094463]
  • Protein family

  • RutC family (single member, according to UniProt)
  • Structure

  • [PDB|1QD9] [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?Dopt=s&uid=11484 NCBI] [Pubmed|10557275]
  • [PDB|5Y6U]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • additional information

  • was originally thought to be required for activity of [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR], but this is due to the orientation of the marker gene downstream of [gene|search|purR ]in the [gene|search|yabJ ]mutant strain used in [pubmed|10368157]
  • Expression and Regulation

    Operons

    genes
    [gene|8FA635D1915108BF29A864AF4DA28ECF633F735F|ispE]-[gene|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]-[gene|285D9E676B06119F9F4D33FC62615EC844D35BC3|yabJ]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, [Pubmed|7638212], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • negative autoregulation [Pubmed|7638212]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B911 (yabJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1910 NBRP B. subtilis, Japan]
  • BKE00480 ([gene|285D9E676B06119F9F4D33FC62615EC844D35BC3|yabJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGTTTTGTGTGGACTGCTT, downstream forward: _UP4_TAATAAGAAAAGTGATTCTG
  • BKK00480 ([gene|285D9E676B06119F9F4D33FC62615EC844D35BC3|yabJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGTTTTGTGTGGACTGCTT, downstream forward: _UP4_TAATAAGAAAAGTGATTCTG
  • References

  • 10368157,7638212,7638212,10557275,22094463