SubtiBank SubtiBank
ybdO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybdO

unknown
locus
BSU_02050
pI
5.36
mw
44.68 kDa
protein length
394 aa Sequence Blast
gene length
1185 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    225,064 226,248

    The protein

    [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|283FB32C92417EA7DFE86FAC2E7FFBD6165B0A5F|ybdO]
    description
    [Pubmed|15033535]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by casamino acids [http://www.ncbi.nlm.nih.gov/pubmed/12107147 PubMed
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B960 (ybdO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1959 NBRP B. subtilis, Japan]
  • BKE02050 ([gene|283FB32C92417EA7DFE86FAC2E7FFBD6165B0A5F|ybdO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAATTCCCTCCCGAGT, downstream forward: _UP4_TAGGTAAGCTGTTCATGTAG
  • BKK02050 ([gene|283FB32C92417EA7DFE86FAC2E7FFBD6165B0A5F|ybdO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAATTCCCTCCCGAGT, downstream forward: _UP4_TAGGTAAGCTGTTCATGTAG
  • References

  • 18957862,15033535,18840696,12107147