SubtiBank SubtiBank
ybfK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybfK

carboxylesterase NP
locus
BSU02260
pI
5.14
mw
32.92 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
function
degradation of isoprenoid-containing lipids
product
carboxylesterase NP
essential
no
ec
3.1.1.1
synonyms
cesB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.4|Utilization of lipids/ other]
  • Gene

    Coordinates
    246,658 247,548

    The protein

    Catalyzed reaction/ biological activity

  • A carboxylic ester + H2O = an alcohol + a carboxylate (according to Swiss-Prot)
  • Protein family

  • AB hydrolase superfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|E5A59EE56092F8042128B19D5E8DEFAE41C78000|Nap]
  • Structure

  • [PDB|4CCY] [Pubmed|24418394]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]-[gene|DE49797486CEC172F912D26A6BF2223190BF5DAD|pssA]-[gene|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|ybfM]-[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]
    description
    [Pubmed|22383849,14762009]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14762009], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B934 (ybfK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1933 NBRP B. subtilis, Japan]
  • BKE02260 ([gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTCTTTTTCCTCC, downstream forward: _UP4_TAGTAAGGAACATGAAAAGA
  • BKK02260 ([gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTCTTTTTCCTCC, downstream forward: _UP4_TAGTAAGGAACATGAAAAGA
  • References

  • 11389736,24418394