SubtiBank SubtiBank
yneP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yneP

putative 4-hydroxybenzoyl coenzyme-A thioesterase
locus
BSU_18040
pI
8.64
mw
13.81 kDa
protein length
121 aa Sequence Blast
gene length
366 bp Sequence Blast
function
unknown
product
putative 4-hydroxybenzoyl coenzyme-A thioesterase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,930,834 1,931,199

    The protein

    Protein family

  • thioesterase family (with [protein|9D0914FC38FFF4028C2BA5970DC87B3A1027E253|SrfAD], according to UniProt)
  • Structure

  • [PDB|5LQL] (from Staphylococcus aureus, 48% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|27C362A132DDFF09E27FC919D0204D4C9E016803|yneP]-[gene|53CBEFFB7FB819E5B4565AC77AC1545CA4E3A874|yneQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE18040 ([gene|27C362A132DDFF09E27FC919D0204D4C9E016803|yneP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATCTGTTTCTGCAT, downstream forward: _UP4_AAAAAATAGGGAAGTGAACG
  • BKK18040 ([gene|27C362A132DDFF09E27FC919D0204D4C9E016803|yneP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATCTGTTTCTGCAT, downstream forward: _UP4_AAAAAATAGGGAAGTGAACG