SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative 4-hydroxybenzoyl coenzyme-A thioesterase
13.81 kDa
protein length
121 aa Sequence Blast
gene length
366 bp Sequence Blast
putative 4-hydroxybenzoyl coenzyme-A thioesterase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,930,834 1,931,199

    The protein

    Protein family

  • thioesterase family (with [protein|9D0914FC38FFF4028C2BA5970DC87B3A1027E253|SrfAD], according to UniProt)
  • Structure

  • [PDB|5LQL] (from Staphylococcus aureus, 48% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE18040 ([gene|27C362A132DDFF09E27FC919D0204D4C9E016803|yneP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATCTGTTTCTGCAT, downstream forward: _UP4_AAAAAATAGGGAAGTGAACG
  • BKK18040 ([gene|27C362A132DDFF09E27FC919D0204D4C9E016803|yneP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATCTGTTTCTGCAT, downstream forward: _UP4_AAAAAATAGGGAAGTGAACG