SubtiBank SubtiBank
xepA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

xepA

PBSX prophage lytic exoenzyme
locus
BSU_12780
pI
5.42
mw
30.26 kDa
protein length
279 aa Sequence Blast
gene length
840 bp Sequence Blast
function
phage release
product
PBSX prophage lytic exoenzyme
essential
no
synonyms
xkdY

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    1,345,839 1,346,678

    The protein

    Paralogous protein(s)

  • [protein|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|YqxG]
  • [protein|4F4F48730C97FBEEEAE6B4080D2DD324C575633E|YomS]: 38% identity to the C-terminal part of [protein|27BB6659541BA5368DEDB19EADCD372CE41244F5|XepA]
  • Structure

  • [PDB|6IA5] [pubmed|31692476]
  • [SW|Localization]

  • extracellular (no signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]-[gene|277F51EB4FE2BAB0FD1808EDE25705E10833AD0A|xtmB]-[gene|E77DD93E3CDCA9B81106E6AB0F18513360AAE9DB|xkdE]-[gene|6542BE447872C1A16C056DA21BD7A23C65F5C543|xkdF]-[gene|38173C76C27A7178CEE66E3642533EB34828C2CB|xkdG]-[gene|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|xkdH]-[gene|5ACCC439AD8849355094F8C5FC6EF29A9077EF58|xkdI]-[gene|6DF19E4546509687CA194F6B44EEB723C9467B9C|xkdJ]-[gene|31B1832E5EAD957EE6A5C7CB0C117EC0F26AA8AB|xkdK]-[gene|683D350D98AC0D27951145AD87830B89C0B4F393|xkdM]-[gene|0BF8AD1ACD0BBA6913636081B41E6D04D16D1BA2|xkdN]-[gene|156A8B699B32B268EBA1A0A1620C95D0DF630A4E|xkzB]-[gene|CD97483876F4FCCE451AD4F2A8AFD6F560074769|xkdO]-[gene|ED35852FAAD386CFB43F8D3DDEF28F7B05EC8B43|xkdP]-[gene|D5FDCC792D0E6B8D35BCDDC0D7B76025ACC900FF|xkdQ]-[gene|AF9706F2EBF056A404B5D7640D78D1E833805225|xkdR]-[gene|C222F247C225FD6DEBB103DFB169AEF87DFC0C0D|xkdS]-[gene|1234C9BC164FB47E003009E943124982260221C0|xkdT]-[gene|BDE032590D5F3504CDB4D6BD545153D681B65ADD|xkdU]-[gene|3BCF7587145CFEDEA2F36512ABF62D6B6A2886C5|xkzA]-[gene|9FAAA2E63B161862396C47CE5D1EA9191847FDAD|xkdV]-[gene|1F152F97AD20DABAC1D83EDC2177F46EAECC562C|xkdW]-[gene|787561F433911D090F801AD493F688895498542F|xkdX]-[gene|27BB6659541BA5368DEDB19EADCD372CE41244F5|xepA]-[gene|630FC0D9BDD243D6BF94DBDE506EC2A9CB0AAFE6|xhlA]-[gene|360D866E939DDB822AFAC589D563B191A88695CD|xhlB]-[gene|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|xlyA]
    description
    [Pubmed|22383849,2110147]

    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • BKE12780 ([gene|27BB6659541BA5368DEDB19EADCD372CE41244F5|xepA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCATCCTCCTTTGAT, downstream forward: _UP4_TAATAGTCTCGGCCCTCGGA
  • BKK12780 ([gene|27BB6659541BA5368DEDB19EADCD372CE41244F5|xepA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCATCCTCCTTTGAT, downstream forward: _UP4_TAATAGTCTCGGCCCTCGGA
  • References

  • 9555893,7921239,18957862,27766092,31692476