SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


PBSX terminase (large subunit)
50.99 kDa
protein length
433 aa Sequence Blast
gene length
1302 bp Sequence Blast
phage DNA replication
PBSX terminase (large subunit)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    1,325,890 1,327,191

    Expression and Regulation



    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE12580 ([gene|277F51EB4FE2BAB0FD1808EDE25705E10833AD0A|xtmB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGAGGGTTGATTTCTTTTA, downstream forward: _UP4_CGAGAAAGGAGGAGGTCATA
  • BKK12580 ([gene|277F51EB4FE2BAB0FD1808EDE25705E10833AD0A|xtmB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGAGGGTTGATTTCTTTTA, downstream forward: _UP4_CGAGAAAGGAGGAGGTCATA
  • References

  • 2110147,8083174