SubtiBank SubtiBank
xtmB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

xtmB

PBSX terminase (large subunit)
locus
BSU_12580
pI
8.87
mw
50.99 kDa
protein length
433 aa Sequence Blast
gene length
1302 bp Sequence Blast
function
phage DNA replication
product
PBSX terminase (large subunit)
essential
no
synonyms
ykxG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    Coordinates
    1,325,890 1,327,191

    Expression and Regulation

    Operons

    genes
    [gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]-[gene|277F51EB4FE2BAB0FD1808EDE25705E10833AD0A|xtmB]-[gene|E77DD93E3CDCA9B81106E6AB0F18513360AAE9DB|xkdE]-[gene|6542BE447872C1A16C056DA21BD7A23C65F5C543|xkdF]-[gene|38173C76C27A7178CEE66E3642533EB34828C2CB|xkdG]-[gene|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|xkdH]-[gene|5ACCC439AD8849355094F8C5FC6EF29A9077EF58|xkdI]-[gene|6DF19E4546509687CA194F6B44EEB723C9467B9C|xkdJ]-[gene|31B1832E5EAD957EE6A5C7CB0C117EC0F26AA8AB|xkdK]-[gene|683D350D98AC0D27951145AD87830B89C0B4F393|xkdM]-[gene|0BF8AD1ACD0BBA6913636081B41E6D04D16D1BA2|xkdN]-[gene|156A8B699B32B268EBA1A0A1620C95D0DF630A4E|xkzB]-[gene|CD97483876F4FCCE451AD4F2A8AFD6F560074769|xkdO]-[gene|ED35852FAAD386CFB43F8D3DDEF28F7B05EC8B43|xkdP]-[gene|D5FDCC792D0E6B8D35BCDDC0D7B76025ACC900FF|xkdQ]-[gene|AF9706F2EBF056A404B5D7640D78D1E833805225|xkdR]-[gene|C222F247C225FD6DEBB103DFB169AEF87DFC0C0D|xkdS]-[gene|1234C9BC164FB47E003009E943124982260221C0|xkdT]-[gene|BDE032590D5F3504CDB4D6BD545153D681B65ADD|xkdU]-[gene|3BCF7587145CFEDEA2F36512ABF62D6B6A2886C5|xkzA]-[gene|9FAAA2E63B161862396C47CE5D1EA9191847FDAD|xkdV]-[gene|1F152F97AD20DABAC1D83EDC2177F46EAECC562C|xkdW]-[gene|787561F433911D090F801AD493F688895498542F|xkdX]-[gene|27BB6659541BA5368DEDB19EADCD372CE41244F5|xepA]-[gene|630FC0D9BDD243D6BF94DBDE506EC2A9CB0AAFE6|xhlA]-[gene|360D866E939DDB822AFAC589D563B191A88695CD|xhlB]-[gene|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|xlyA]
    description
    [Pubmed|22383849,2110147]

    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • BKE12580 ([gene|277F51EB4FE2BAB0FD1808EDE25705E10833AD0A|xtmB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGAGGGTTGATTTCTTTTA, downstream forward: _UP4_CGAGAAAGGAGGAGGTCATA
  • BKK12580 ([gene|277F51EB4FE2BAB0FD1808EDE25705E10833AD0A|xtmB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGAGGGTTGATTTCTTTTA, downstream forward: _UP4_CGAGAAAGGAGGAGGTCATA
  • References

  • 2110147,8083174