SubtiBank SubtiBank
ytlD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytlD

similar to [SW|ABC transporter] (permease)
locus
BSU_30620
pI
9.77
mw
30.15 kDa
protein length
270 aa Sequence Blast
gene length
813 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (permease)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,134,144 3,134,956

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 74-255) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|56E482D9CAC6E350140FD21A1C4AC8820B918CDA|ytlA]-[gene|3DC6A032B0F076A460FE2C3244D747CFC7583FE7|ytlC]-[gene|2768A088A2902FA776CB656F29A6F4B0C9E69CA7|ytlD]
    description
    [Pubmed|9387221]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A298 (ytlD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/298 NBRP B. subtilis, Japan]
  • BKE30620 ([gene|2768A088A2902FA776CB656F29A6F4B0C9E69CA7|ytlD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAATTGATACTGCTCGTGAA, downstream forward: _UP4_TAAAAAACCCGGCACATGTG
  • BKK30620 ([gene|2768A088A2902FA776CB656F29A6F4B0C9E69CA7|ytlD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAATTGATACTGCTCGTGAA, downstream forward: _UP4_TAAAAAACCCGGCACATGTG
  • References

  • 10092453,15699190,15383836,9387221