SubtiBank SubtiBank
iolI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

iolI

inosose isomerase, converts 2KMI to 1-keto-D-chiro-inositol
locus
BSU_39680
pI
4.66
mw
31.50 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
function
myo-inositol catabolism
product
inosose isomerase, converts 2KMI to 1-keto-D-chiro-inositol
essential
no
synonyms
yxdH

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • Gene

    Coordinates
    4,073,974 4,074,810

    The protein

    Catalyzed reaction/ biological activity

  • 2,4,6/3,5-pentahydroxycyclohexanone --> 2,3,5/4,6-pentahydroxycyclohexanone (according to UniProt)
  • scyllo-inosose --> scyllo-inosine (according to UniProt)
  • Protein family

  • IolI family (single member, according to UniProt)
  • Structure

  • [PDB|1L60]
  • Expression and Regulation

    Operons

    genes
    [gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]-[gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]-[gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]-[gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]-[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]-[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]-[gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]-[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]-[gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]-[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
    description
    [Pubmed|9226270]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9887260,9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B700 (iolI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1699 NBRP B. subtilis, Japan]
  • BKE39680 ([gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGACTCCCCCATCT, downstream forward: _UP4_TAATGGATAAAGGAGGGGTG
  • BKK39680 ([gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGACTCCCCCATCT, downstream forward: _UP4_TAATGGATAAAGGAGGGGTG
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,9887260,18310071