SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


44.09 kDa
protein length
387 aa Sequence Blast
gene length
1164 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    4,137,626 4,138,789

    Expression and Regulation



    regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|21636651], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|21636651]
  • view in new tab

    Biological materials


  • MGNA-B818 (yycP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40270 ([gene|271543C0F92164723DC26F8A6E1181B7C007692B|yycP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCACTTTTTCATAGCCT, downstream forward: _UP4_AGGTTTTAAGGCAAGGAGGG
  • BKK40270 ([gene|271543C0F92164723DC26F8A6E1181B7C007692B|yycP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCACTTTTTCATAGCCT, downstream forward: _UP4_AGGTTTTAAGGCAAGGAGGG
  • References

  • 22383849