SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


11.78 kDa
protein length
102 aa Sequence Blast
gene length
309 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    4,035,990 4,036,298

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B787 (yxxE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39280 ([gene|2710D9FD5FA50E09B4E482C13140F69B13C71861|yxxE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATCTTGCTCCTTTA, downstream forward: _UP4_TAACGATTCATAACCTTGAT
  • BKK39280 ([gene|2710D9FD5FA50E09B4E482C13140F69B13C71861|yxxE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATCTTGCTCCTTTA, downstream forward: _UP4_TAACGATTCATAACCTTGAT
  • References

  • 7883710,10746760