SubtiBank SubtiBank
ywfO [2019-03-12 19:45:51]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywfO [2019-03-12 19:45:51]

putative metal-dependent phosphohydrolase
50.81 kDa
protein length
433 aa Sequence Blast
gene length
1302 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,859,535 3,860,836

    The protein


  • [SW|HD domain] (aa 57 ... 198) (according to the Interpro database)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A585 (ywfO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37600 ([gene|268A50A41FB6CAB0D768201996C5DF5DADCCA0B7|ywfO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTCATTCCCTCTTTTT, downstream forward: _UP4_TAGAAATTGGAAAGAAGGAA
  • BKK37600 ([gene|268A50A41FB6CAB0D768201996C5DF5DADCCA0B7|ywfO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTCATTCCCTCTTTTT, downstream forward: _UP4_TAGAAATTGGAAAGAAGGAA