SubtiBank SubtiBank
ywqA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywqA

similar to SNF2 helicase
locus
BSU_36280
pI
5.01
mw
105.83 kDa
protein length
922 aa Sequence Blast
gene length
2769 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.8|Genetics/ other/ based on similarity]
  • Gene

    Coordinates
    3,735,449 3,738,217

    The protein

    Protein family

  • [SW|helicase family] (according to UniProt)
  • SNF2/RAD54 helicase family (with [protein|565D91F3E0357C5B16CC342FCDA7EFD4B910829C|YqhH], according to UniProt)
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 462-625) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 753-907) (according to UniProt)
  • Structure

  • [PDB|1Z6A] (from Sulfolobus solfataricus, the C-terminal domain (aa 445 ... 919), 47% identity) [pubmed|15882619]
  • Expression and Regulation

    Operons

    genes
    [gene|6AFE06E2F5A5382FBC656E6D532E1D8BFECC4DC2|ywqB]-[gene|265490FA83D6D3F178C26C9240E3CB224513BF42|ywqA]
    description
    [Pubmed|22383849]

    additional information

  • An [ncRNA|search|antisense RNA] is predicted for [gene|265490FA83D6D3F178C26C9240E3CB224513BF42|ywqA] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A532 (ywqA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/532 NBRP B. subtilis, Japan]
  • BKE36280 ([gene|265490FA83D6D3F178C26C9240E3CB224513BF42|ywqA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTTCGACGTGGATGAGAA, downstream forward: _UP4_TAATCATGACTAAAAAAGCT
  • BKK36280 ([gene|265490FA83D6D3F178C26C9240E3CB224513BF42|ywqA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTTCGACGTGGATGAGAA, downstream forward: _UP4_TAATCATGACTAAAAAAGCT
  • References

  • 9353933,20525796,24147116,15882619