SubtiBank SubtiBank
pncA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pncA

nicotinamidase
locus
BSU_31760
pI
5.60
mw
20.38 kDa
protein length
183 aa Sequence Blast
gene length
552 bp Sequence Blast
function
NAD salvage
product
nicotinamidase
essential
no
synonyms
yueJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.11|Biosynthesis of NAD(P)]
  • Gene

    Coordinates
    3,260,891 3,261,442

    The protein

    Catalyzed reaction/ biological activity

  • deamination of nicotinamide to nicotinic acid [pubmed|30107912]
  • Protein family

  • [SW|Isochorismatase family] (according to UniProt)
  • Structure

  • [PDB|5ZN8]
  • [PDB|6A8L]
  • Expression and Regulation

    Operons

    genes
    [gene|26430DCCEC263E7D03A3BBA4E7D636A250C3208B|pncA]-[gene|7CA7ADDBDDE46B0E6522704FD19C0BCF6FA9E058|pncB]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|17F2619E74A1604E86ED94E1BEE683D49E437A6C|yueH]-[gene|3918D82756A64E86E96A21ACEB34B0CF992D662D|yueI]-[gene|26430DCCEC263E7D03A3BBA4E7D636A250C3208B|pncA]-[gene|7CA7ADDBDDE46B0E6522704FD19C0BCF6FA9E058|pncB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B563 (yueJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1562 NBRP B. subtilis, Japan]
  • BKE31760 ([gene|26430DCCEC263E7D03A3BBA4E7D636A250C3208B|pncA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCCGGCCTCCCCGCCA, downstream forward: _UP4_GCAGAGTAAGGAAGGGGAAA
  • BKK31760 ([gene|26430DCCEC263E7D03A3BBA4E7D636A250C3208B|pncA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCCGGCCTCCCCGCCA, downstream forward: _UP4_GCAGAGTAAGGAAGGGGAAA
  • References

    Research papers

  • 30107912