SubtiBank SubtiBank
bkdB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bkdB

2-oxoisovalerate dehydrogenase (E2 subunit, lipoamide acyltransferase)
locus
BSU24030
pI
5.30
mw
45.67 kDa
protein length
424 aa Sequence Blast
gene length
1275 bp Sequence Blast
function
utilization of branched-chain keto acids
product
2-oxoisovalerate dehydrogenase (E2 subunit, lipoamide acyltransferase)
essential
no
ec
2.3.1.168
synonyms
bfmBB,bfmB2,bkd

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • Gene

    Coordinates
    2,496,796 2,498,070

    The protein

    Catalyzed reaction/ biological activity

  • 2-methylpropanoyl-CoA + enzyme N(6)-(dihydrolipoyl)lysine = CoA + enzyme N(6)-(S-(2-methylpropanoyl)dihydrolipoyl)lysine (according to Swiss-Prot)
  • Protein family

  • [SW|2-oxoacid dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC], [protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|AcoC], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB]
  • [SW|Cofactors]

  • lipoic acid (on Lys-44), can probably be removed by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|SrtN] [pubmed|28900027]
  • Structure

  • [PDB|3DUF] (Geobacillus stearothermophilus [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC], 36% identity) [pubmed|19081062]
  • [SW|Localization]

  • Nucleoid (Heterogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]-[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd]-[gene|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk]-[gene|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV]-[gene|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]-[gene|A024921961A786294199EA12E04456C890ED8D8C|bkdAB]-[gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]
    description
    [Pubmed|12823818]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|10094682], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|4CEBD81F485DD0B660E297FFC34A0F5270652184|BkdR]: activation, [Pubmed|10094682], in [regulon|4CEBD81F485DD0B660E297FFC34A0F5270652184|BkdR regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|10094682], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • induced in the presence of isoleucine or valine ([protein|search|BkdR]) [Pubmed|10094682]
  • view in new tab

    Biological materials

    Mutant

  • BKE24030 ([gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTATCCTCCCTTA, downstream forward: _UP4_TAAATAAGCAAAAAGAGCAT
  • BKK24030 ([gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTATCCTCCCTTA, downstream forward: _UP4_TAAATAAGCAAAAAGAGCAT
  • References

    Reviews

  • 27074917
  • Original publications

  • 12427936,15241682,10094682,10094682,16479537,12823818,28900027,19081062,31066113