SubtiBank SubtiBank
yydG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yydG

radical SAM epimerase, modification of [protein|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|YydF]
locus
BSU_40170
pI
5.86
mw
37.06 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
control of [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]-[protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|LiaS] activity
product
radical SAM epimerase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.8|Protein modification/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    4,126,481 4,127,440

    The protein

    Catalyzed reaction/ biological activity

  • epimerization of Val-36 and Ile-44 of [protein|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|YydF] to the D-form [pubmed|28644475]
  • Protein family

  • radical SAM enzymes [pubmed|28644475]
  • [SW|Cofactors]

  • two Fe-S clusters [pubmed|28644475]
  • SAM [pubmed|28644475]
  • Expression and Regulation

    Operons

    genes
    [gene|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|yydF]-[gene|25FC87037222084ABE318813959101016FEB49DF|yydG]-[gene|E280A5994F4D9D93DA4B698E79C86360DBEE5396|yydH]-[gene|1BF1A48CF645249CA9ECBB19C04B059B11D821EF|yydI]-[gene|A4213DE6C9BE29405B0A4C0A969A78EA4C5EB71F|yydJ]
    description
    [Pubmed|17921301]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17921301], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|17921301], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • regulation

  • activated after transition to stationary phase([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|17921301]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B810 (yydG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1809 NBRP B. subtilis, Japan]
  • BKE40170 ([gene|25FC87037222084ABE318813959101016FEB49DF|yydG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATATCCCCCAACAA, downstream forward: _UP4_TATCCTTATATGGAAAAATA
  • BKK40170 ([gene|25FC87037222084ABE318813959101016FEB49DF|yydG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATATCCCCCAACAA, downstream forward: _UP4_TATCCTTATATGGAAAAATA
  • References

    Reviews

  • 23106164
  • Original publications

  • 17921301,12850135,17921301,21815947,23199363,28644475