SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


small acid-soluble spore protein (major gamma-type SASP)
9.13 kDa
protein length
gene length
255 bp Sequence Blast
protection of spore DNA
small acid-soluble spore protein (major gamma-type SASP)

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Small acid-soluble spore proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    937,900 938,154

    The protein

    Protein family

  • gamma-type SASP family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-16 [pubmed|31221751]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10463184], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • [protein|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|YfhP]: repression, in [regulon|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|YfhP regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10463184], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1900507], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|YfhP]: repression, in [regulon|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|YfhP regulon]
  • regulation

  • expression is constitutive throughout growth [Pubmed|20971907]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials


  • MGNA-C365 (sspE::erm), available at the [ NBRP B. subtilis, Japan]
  • 1S112 (no resistance), [Pubmed|3125155], available at [ BGSC]
  • 1S113 (no resistance), [Pubmed|3125155], available at [ BGSC]
  • BKE08660 ([gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTATCACCTCCACGG, downstream forward: _UP4_TAATCACTGAAACAGAAAAA
  • BKK08660 ([gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTATCACCTCCACGG, downstream forward: _UP4_TAATCACTGAAACAGAAAAA
  • References

  • 3106326,1900507,2456528,2497051,11092849,12107147,10463184,23314362,30782632,31221751