SubtiBank SubtiBank
rapA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rapA

response regulator aspartate phosphatase, dephosphorylates Spo0F-P, control of the phosphorelay
locus
BSU_12430
pI
4.85
mw
44.81 kDa
protein length
378 aa Sequence Blast
gene length
1137 bp Sequence Blast
function
control of sporulation initiation
product
response regulator aspartate phosphatase
essential
no
synonyms
gsiAA,spo0L

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.2|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.5|Phosphatases controlling the phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.5|Phosphatases controlling the phosphorelay]
  • Gene

    Coordinates
    1,315,869 1,317,005

    The protein

    Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • modular organization comprising an amino terminal alpha-helical domain connected to a domain formed by six [SW|TPR repeat|tetratrichopeptide repeats] [Pubmed|11923303,22267516]
  • Structure

  • [PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF], 42% identity) [pubmed|23526880]
  • Expression and Regulation

    Operons

    genes
    [gene|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]-[gene|D31B325366D3F0169E4ECA8871645C7826019C10|phrA]
    description
    [Pubmed|1378051]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1378051], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|23569278,12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
  • view in new tab

    Biological materials

    Mutant

  • BKE12430 ([gene|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAATCCCCCCTTTTGA, downstream forward: _UP4_CAAATCCAGAGAGGAGATTG
  • BKK12430 ([gene|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAATCCCCCCTTTTGA, downstream forward: _UP4_CAAATCCAGAGAGGAGATTG
  • References

  • 8643670,8730857,11923303,22267516,14651647,12618455,12107147,19380751,12850135,1378051,16091051,23569278,26582911,27122155,23526880