SubtiBank SubtiBank
ykoN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykoN

unknown
locus
BSU_13350
pI
8.76
mw
43.32 kDa
protein length
373 aa Sequence Blast
gene length
1122 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,398,975 1,400,096

    The protein

    Protein family

  • glycosyltransferase 28 family (with [protein|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|UgtP] and [protein|D52FDB5015B10E9B26D7FED5708457890C6EA43D|MurG], according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A760 (ykoN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/760 NBRP B. subtilis, Japan]
  • BKE13350 ([gene|25CECB2D3C7925408DB96A156745BAD6A6FAB0AC|ykoN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGTCCTCCTAAAAA, downstream forward: _UP4_CTGAAATAGAGAGTGTAGAA
  • BKK13350 ([gene|25CECB2D3C7925408DB96A156745BAD6A6FAB0AC|ykoN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGTCCTCCTAAAAA, downstream forward: _UP4_CTGAAATAGAGAGTGTAGAA