SubtiBank SubtiBank
yncM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yncM

unknown
locus
BSU_17690
pI
9.97
mw
26.45 kDa
protein length
250 aa Sequence Blast
gene length
753 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,903,511 1,904,263

    The protein

    Paralogous protein(s)

  • [protein|CB6300378FE7F14A9C7C664A533D73D513857FD7|YrpD]
  • Structure

  • [PDB|4HFS]
  • [SW|Localization]

  • extracellular (signal peptide), major constituent of the secretome [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|258DD30EA27B6A2E81B8359E43203C37F588037A|yncM]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B384 (yncM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1383 NBRP B. subtilis, Japan]
  • BKE17690 ([gene|258DD30EA27B6A2E81B8359E43203C37F588037A|yncM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTATACCTTATTTT, downstream forward: _UP4_TAAACGAAGCAGCAAAAAGC
  • BKK17690 ([gene|258DD30EA27B6A2E81B8359E43203C37F588037A|yncM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTATACCTTATTTT, downstream forward: _UP4_TAAACGAAGCAGCAAAAAGC
  • References

  • 18957862,20817675