SubtiBank SubtiBank
etfB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

etfB

electron transfer flavoprotein (beta subunit)
locus
BSU_28530
pI
4.19
mw
28.37 kDa
protein length
257 aa Sequence Blast
gene length
774 bp Sequence Blast
function
fatty acid degradation
product
electron transfer flavoprotein (beta subunit)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.3|Utilization of fatty acids]
  • Gene

    Coordinates
    2,916,378 2,917,151

    The protein

    Protein family

  • ETF beta-subunit/fixA family (single member, according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|1EFP] (from Paracoccus denitrificans, 37% identity) [pubmed|10026281]
  • Expression and Regulation

    Operons

    genes
    [gene|7AC5217CA35F8E134ABB35D74F1BA5E684D2E058|lcfA]-[gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]-[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]-[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]-[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]
    description
    [Pubmed|17189250]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21398533], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|21398533], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by long chain acyl-CoA (C14 ... C20) ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • expression of the operon is strongly induced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    genes
    [gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]-[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]-[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]-[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]
    description
    [Pubmed|17189250]

    regulation

  • induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials

    Mutant

  • 1A855 ( ''etfB''::''cat''), [Pubmed|17085570], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A855&Search=1A855 BGSC]
  • BKE28530 (''[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE28530 ([gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGATTCATGATCATATCCC, downstream forward: _UP4_TAAAACTTGGACATTCAAAG
  • BKK28530 ([gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGATTCATGATCATATCCC, downstream forward: _UP4_TAAAACTTGGACATTCAAAG
  • References

  • 17189250,17919287,17085570,10026281