SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


27.60 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,387,854 2,388,588

    Phenotypes of a mutant

  • the spores are not heat-resistant and defective in morphology [pubmed|32061128]
  • The protein


  • cytoplasm [pubmed|32061128]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-A403 (yphF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22810 ([gene|250869DE4A5EDD7E8F26F27C94695D777FAD4889|yphF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCACTTCCTTTTAC, downstream forward: _UP4_TGAACCTTTCTCCCTTGCAT
  • BKK22810 ([gene|250869DE4A5EDD7E8F26F27C94695D777FAD4889|yphF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCACTTCCTTTTAC, downstream forward: _UP4_TGAACCTTTCTCCCTTGCAT
  • References

  • 20817675,32061128