SubtiBank SubtiBank
yphF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yphF

unknown
locus
BSU_22810
pI
5.63
mw
27.60 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
johF

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,387,854 2,388,588

    The protein

    [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|231FFD626594226B2A46BEE70C851468DA861795|yphE]-[gene|250869DE4A5EDD7E8F26F27C94695D777FAD4889|yphF]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A403 (yphF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/403 NBRP B. subtilis, Japan]
  • BKE22810 ([gene|250869DE4A5EDD7E8F26F27C94695D777FAD4889|yphF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCACTTCCTTTTAC, downstream forward: _UP4_TGAACCTTTCTCCCTTGCAT
  • BKK22810 ([gene|250869DE4A5EDD7E8F26F27C94695D777FAD4889|yphF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCACTTCCTTTTAC, downstream forward: _UP4_TGAACCTTTCTCCCTTGCAT
  • References

  • 20817675