SubtiBank SubtiBank
tpx
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tpx

probable thiol peroxidase
locus
BSU_29490
pI
4.70
mw
18.07 kDa
protein length
167 aa Sequence Blast
gene length
504 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ytgI

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,017,696 3,018,199

    The protein

    Catalyzed reaction/ biological activity

  • [protein]-dithiol + hydroperoxide --> [protein]-disulfide + alcohol + H2O (according to UniProt)
  • Protein family

  • [SW|peroxiredoxin family] (according to UniProt)
  • [SW|Domains]

  • [SW|Thioredoxin domain] (aa 18-167) (according to UniProt)
  • Structure

  • [PDB|2JSZ]
  • Expression and Regulation

    Operons

    genes
    [gene|2501228D435B151F151A3C0EF10DE99A8395977F|tpx]-[gene|2C83EECFA809F34ADCA6445CF2E6BAC730D523DB|ytxK]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|12642660,19575568], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    genes
    [gene|2501228D435B151F151A3C0EF10DE99A8395977F|tpx]
    description
    [Pubmed|9387221]

    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|12642660,19575568], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A113 (ytgI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/113 NBRP B. subtilis, Japan]
  • BKE29490 ([gene|2501228D435B151F151A3C0EF10DE99A8395977F|tpx]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAATTCCTCCCTTTT, downstream forward: _UP4_TAAGCAGGGAAAAAAGCTCC
  • BKK29490 ([gene|2501228D435B151F151A3C0EF10DE99A8395977F|tpx]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAATTCCTCCCTTTT, downstream forward: _UP4_TAAGCAGGGAAAAAAGCTCC
  • References

  • 19636900,9387221,12642660