SubtiBank SubtiBank
tpx
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tpx

probable thiol peroxidase
locus
BSU29490
pI
4.70
mw
18.07 kDa
protein length
167 aa Sequence Blast
gene length
504 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ytgI

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,017,696 3,018,199

    The protein

    Protein family

  • [SW|peroxiredoxin family] (according to Swiss-Prot)
  • Structure

  • [PDB|2JSZ]
  • Expression and Regulation

    Operons

    genes
    [gene|2501228D435B151F151A3C0EF10DE99A8395977F|tpx]-[gene|2C83EECFA809F34ADCA6445CF2E6BAC730D523DB|ytxK]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|12642660,19575568], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    genes
    [gene|2501228D435B151F151A3C0EF10DE99A8395977F|tpx]
    description
    [Pubmed|9387221]

    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|12642660,19575568], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A113 (ytgI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/113 NBRP B. subtilis, Japan]
  • BKE29490 ([gene|2501228D435B151F151A3C0EF10DE99A8395977F|tpx]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAATTCCTCCCTTTT, downstream forward: _UP4_TAAGCAGGGAAAAAAGCTCC
  • BKK29490 ([gene|2501228D435B151F151A3C0EF10DE99A8395977F|tpx]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAATTCCTCCCTTTT, downstream forward: _UP4_TAAGCAGGGAAAAAAGCTCC
  • References

  • 19636900,9387221,12642660