SubtiBank SubtiBank
sigK [2019-04-14 15:41:33]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

sigK [2019-04-14 15:41:33]

[SW|RNA polymerase ][SW|sporulation]-specific [SW|sigma factor ](sigma-K) (5' part of the interrupted [gene|search|sigK] gene), with [gene|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|sigKC]
17.00 kDa
protein length
156 aa Sequence Blast
gene length
471 bp Sequence Blast
late mother cell-specific gene expression
[SW|RNA polymerase ][SW|sporulation]-specific [SW|sigma factor](sigma-K) (5' part of the gene)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,652,993 2,653,463

    The protein

    Protein family

  • sigma-70 factor family (according to Swiss-Prot)
  • Expression and Regulation


    (composed of [SW|spoIVCB]-[SW|spoIIIC]) [Pubmed|2536191]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,2841290], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|2841290], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|10075739], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|7966271], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|25983726], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE], [SW|SpoIIID]) [Pubmed|15699190,2841290,10075739,7966271]
  • additional information

  • 'spoIVCB' and '[protein|search|spoIIIC]' form a composite gene in the mother cell during sporulation by excising the intervening DNA sequence.
  • view in new tab

    Biological materials


  • BKE25760 ([gene|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTCACCTCCACAAAAG, downstream forward: _UP4_AAAGGGGGGTGCATACACCC
  • BKK25760 ([gene|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTCACCTCCACAAAAG, downstream forward: _UP4_AAAGGGGGGTGCATACACCC
  • Labs working on this gene/protein

  • [SW|Arthur Aronson], Purdue University, West Lafayette, USA [ homepage]
  • [SW|Charles Moran], Emory University, NC, USA [ homepage]
  • References


  • 20833318,20836086
  • The [SW|SigK regulon]

  • 16385044,15383836,21670523
  • Original Publications

  • 14526016,17720779,1900494,10438769,2492118,1691789,2536191,2163341,10931284,1577688,9852018,1942049,7814326,8550479,11959848,9501233,10400595,2115401,7592342,1518043,8226681,9078383,2514119,10611287,14523132,19805276,10075739,7966271,17890309,23585539,23995631,25983726,26953342,29180425,30403663