SubtiBank SubtiBank
sqhC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sqhC

squalene-hopene cyclase, biosynthesis of sporulenes, protection of the spore against oxidative stress
locus
BSU_19320
pI
7.63
mw
71.05 kDa
protein length
632 aa Sequence Blast
gene length
1899 bp Sequence Blast
function
biosynthesis of sporulenes
product
squalene-hopene cyclase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,102,168 2,104,066

    The protein

    Catalyzed reaction/ biological activity

  • sporulenol --> H2O + tetraprenyl-β-curcumene (according to UniProt)
  • production of sporulenes, polycyclic terpenoid lipids [Pubmed|18436644]
  • protection of the spore against oxidative stress [Pubmed|18436644]
  • Protein family

  • terpene cyclase/mutase family (single member, according to UniProt)
  • Structure

  • [PDB|2SQC] (from Alicyclobacillus acidocaldarius, 32% identity) [pubmed|9931258]
  • [SW|Localization]

  • surrounds the forespores [Pubmed|18436644]
  • Expression and Regulation

    Operons

    genes
    [gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]-[gene|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]
    description
    [Pubmed|18436644]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,18436644], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell [Pubmed|18436644]
  • view in new tab

    Biological materials

    Mutant

  • BKE19320 ([gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGCTCAACTCCTTCA, downstream forward: _UP4_GATTCTATTGAAAAGGAGAC
  • BKK19320 ([gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGCTCAACTCCTTCA, downstream forward: _UP4_GATTCTATTGAAAAGGAGAC
  • References

  • 18436644,9931258