SubtiBank SubtiBank
sqhC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sqhC

squalene-hopene cyclase, biosynthesis of sporulenes, protection of the spore against oxidative stress
locus
BSU19320
pI
7.63
mw
71.05 kDa
protein length
632 aa Sequence Blast
gene length
1899 bp Sequence Blast
function
biosynthesis of sporulenes
product
squalene-hopene cyclase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,102,168 2,104,066

    The protein

    Catalyzed reaction/ biological activity

  • Squalene = hop-22(29)-ene (according to Swiss-Prot), production of sporulenes, polycyclic terpenoid lipids [Pubmed|18436644]
  • protection of the spore against oxidative stress [Pubmed|18436644]
  • Structure

  • [PDB|2SQC] (from Alicyclobacillus acidocaldarius, 32% identity) [pubmed|9931258]
  • [SW|Localization]

  • surrounds the forespores [Pubmed|18436644]
  • Expression and Regulation

    Operons

    genes
    [gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]-[gene|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]
    description
    [Pubmed|18436644]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,18436644], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell [Pubmed|18436644]
  • view in new tab

    Biological materials

    Mutant

  • BKE19320 ([gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGCTCAACTCCTTCA, downstream forward: _UP4_GATTCTATTGAAAAGGAGAC
  • BKK19320 ([gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGCTCAACTCCTTCA, downstream forward: _UP4_GATTCTATTGAAAAGGAGAC
  • References

  • 18436644,9931258