SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


antagonist of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR], drives [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR] from the [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR](LOW) to the [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR](HIGH) state
6.47 kDa
protein length
gene length
174 bp Sequence Blast
control of [SW|biofilm formation]
antagonist of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • Gene

    Phenotypes of a mutant

  • altered cell death pattern in colonies [Pubmed|23012477]
  • The protein

    Paralogous protein(s)

  • [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA]
  • [SW|Domains]

  • [SW|Sin domain] (aa 2-40) (according to UniProt)
  • Structure

  • [PDB|5TMX] [pubmed|31493408]
  • [PDB|1B0N] (complex [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]-[protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI]) [Pubmed|9799632]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3125149], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, in a portion of cells [Pubmed|11751836], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|1664536], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|7635837,11751836], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [PubMed|1906467,11751836], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • repressed during exponential growth ([protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]) [,11751836 PubMed]
  • additional information

  • the mRNA is stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • GP959 (spc), available in [SW|Jörg Stülke]'s lab
  • DS91 (spc) NCIB3610 derivate, available in [SW|Jörg Stülke]'s lab
  • 1S98 ( ''sinI''::''kan''), [Pubmed|11466285], available at [ BGSC]
  • GP1663 (''[gene|22BEB39F735DAAF71F1B382CD453A9C2D4CC9FA4|yqhG]-[gene|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]-[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]''), available in [SW|Jörg Stülke]'s lab
  • BKE24600 ([gene|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGTTTCTCCTCCTAA, downstream forward: _UP4_TGAATGTGCTATAATATCAC
  • BKK24600 ([gene|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGTTTCTCCTCCTAA, downstream forward: _UP4_TGAATGTGCTATAATATCAC
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 20541494
  • Modelling of the [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI]]/[[SinR] switch

  • 21095906
  • Original publications

  • 23430750,23012477,21326214,21815947,3125149,15661000,18047568,11751836,1906467,11751836,7635837,11751836,10547280,15104138,9799632,20923420,8422983,24256735,31493408,31604312