SubtiBank SubtiBank
sinI
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

sinI

antagonist of SinR, drives SlrR from the SlrR(LOW) to the SlrR(HIGH) state
locus
BSU24600
pI
6.33
mw
6.47 kDa
protein length
gene length
171 bp Sequence Blast
function
control of biofilm formation
product
antagonist of SinR
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation]
  • Gene

    Phenotypes of a mutant

  • altered cell death pattern in colonies [Pubmed|23012477]
  • The protein

    Paralogous protein(s)

  • [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA]
  • Structure

  • [PDB|1B0N] (complex [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]-[protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI]) [Pubmed|9799632]
  • Expression and Regulation

    Operons

    genes
    [gene|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]-[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]
    description
    [Pubmed|3125149]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3125149], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, in a portion of cells [Pubmed|11751836], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|1664536], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|7635837,11751836], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [PubMed|1906467,11751836], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • repressed during exponential growth ([protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]) [http://www.ncbi.nlm.nih.gov/sites/entrez/1906467,11751836 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • GP959 (spc), available in [SW|Jörg Stülke]'s lab
  • DS91 (spc) NCIB3610 derivate, available in [SW|Jörg Stülke]'s lab
  • 1S98 ( ''sinI''::''kan''), [Pubmed|11466285], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S98&Search=1S98 BGSC]
  • GP1663 (''[gene|22BEB39F735DAAF71F1B382CD453A9C2D4CC9FA4|yqhG]-[gene|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]-[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]''), available in [SW|Jörg Stülke]'s lab
  • BKE24600 (Δ[gene|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGTTTCTCCTCCTAA, downstream forward: _UP4_TGAATGTGCTATAATATCAC
  • BKK24600 (Δ[gene|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGTTTCTCCTCCTAA, downstream forward: _UP4_TGAATGTGCTATAATATCAC
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 20541494
  • Modelling of the [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI]]/[[SinR] switch

  • 21095906
  • Original publications

  • 23430750,23012477,21326214,21815947,3125149,15661000,18047568,11751836,1906467,11751836,7635837,11751836,10547280,15104138,9799632,20923420,8422983,24256735