SubtiBank SubtiBank
recG [2019-04-12 13:51:35]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

recG [2019-04-12 13:51:35]

ATP-dependent DNA helicase, branch migration translocase, required for DNA repair and chromosomal segregation
77.96 kDa
protein length
682 aa Sequence Blast
gene length
2049 bp Sequence Blast
DNA repair and chromosomal segregation
ATP-dependent DNA helicase, branch migration translocase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    1,659,810 1,661,858

    Phenotypes of a mutant

  • a [gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2] [gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG] double mutant is not viable [pubmed|28527403]
  • The protein

    Catalyzed reaction/ biological activity

  • binds and unwinds Holliday junction DNA [Pubmed|24770420]
  • Protein family

  • helicase C-terminal domain (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|AD1F39823ABCE2A222259B879513752942C59590|Mfd]
  • Structure

  • [PDB|1GM5] (from ''Thermotoga maritima'', 43% identity, 62% similarity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • 1A897 (no resistance), [Pubmed|16020779], available at [ BGSC]
  • BKE15870 ([gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCAATACCCTTAATGTTAG, downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG
  • BKK15870 ([gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCAATACCCTTAATGTTAG, downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG
  • References

  • 17853894,15533834,17640277,24770420,21170359,28527403