SubtiBank SubtiBank
recG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

recG

ATP-dependent DNA helicase, branch migration translocase, required for DNA repair and chromosomal segregation
locus
BSU_15870
pI
7.09
mw
77.96 kDa
protein length
682 aa Sequence Blast
gene length
2049 bp Sequence Blast
function
DNA repair and chromosomal segregation
product
ATP-dependent DNA helicase, branch migration translocase
essential
no
synonyms
ylpB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    1,659,810 1,661,858

    Phenotypes of a mutant

  • a [gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2] [gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG] double mutant is not viable [pubmed|28527403]
  • a [gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG] [gene|151F226370D225776F3FE7EA4901485095F1AC45|radA] double mutant is non-transformable with chromosomal DNA [pubmed|31350886]
  • The protein

    Catalyzed reaction/ biological activity

  • binds and unwinds Holliday junction DNA [Pubmed|24770420]
  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|helicase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|AD1F39823ABCE2A222259B879513752942C59590|Mfd]
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 271-432) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 451-611) (according to UniProt)
  • Structure

  • [PDB|1GM5] (from ''Thermotoga maritima'', 43% identity, 62% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|BC19D5B3764503298ED7136FC9F63A68F6AC464F|sdaAB]-[gene|8361D87307D2E8350945F592ABD24E2109E2E81A|sdaAA]-[gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • 1A897 (no resistance), [Pubmed|16020779], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A897&Search=1A897 BGSC]
  • BKE15870 ([gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCAATACCCTTAATGTTAG, downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG
  • BKK15870 ([gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCAATACCCTTAATGTTAG, downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG
  • References

  • 17853894,15533834,17640277,24770420,21170359,28527403,31350886