SubtiBank SubtiBank
yqbO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbO

similar to phage-related protein
locus
BSU_26030
pI
10.20
mw
170.78 kDa
protein length
1585 aa Sequence Blast
gene length
4758 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    2,672,706 2,677,463

    The protein

    Modification

  • phosphorylation on Ser-970 AND Ser-972 [Pubmed|17218307]
  • Biological materials

    Mutant

  • BKE26030 ([gene|249DB77A83EE6D1EFDCB5C3D14A7801DD236294D|yqbO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTGGCTGTTAGTTTAGCCA, downstream forward: _UP4_ATTGGAACGAAGGGAGTCGT
  • BKK26030 ([gene|249DB77A83EE6D1EFDCB5C3D14A7801DD236294D|yqbO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTGGCTGTTAGTTTAGCCA, downstream forward: _UP4_ATTGGAACGAAGGGAGTCGT
  • References

  • 17218307