SubtiBank SubtiBank
yqbO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbO

similar to phage-related protein
locus
BSU26030
pI
10.20
mw
170.78 kDa
protein length
1585 aa Sequence Blast
gene length
4758 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    2,672,706 2,677,463

    The protein

    Modification

  • phosphorylation on Ser-970 AND Ser-972 [Pubmed|17218307]
  • Biological materials

    Mutant

  • BKE26030 ([gene|249DB77A83EE6D1EFDCB5C3D14A7801DD236294D|yqbO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTGGCTGTTAGTTTAGCCA, downstream forward: _UP4_ATTGGAACGAAGGGAGTCGT
  • BKK26030 ([gene|249DB77A83EE6D1EFDCB5C3D14A7801DD236294D|yqbO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTGGCTGTTAGTTTAGCCA, downstream forward: _UP4_ATTGGAACGAAGGGAGTCGT
  • References

  • 17218307