SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to phage-related protein
170.78 kDa
protein length
1585 aa Sequence Blast
gene length
4758 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    2,672,706 2,677,463

    The protein


  • phosphorylation on Ser-970 AND Ser-972 [Pubmed|17218307]
  • Biological materials


  • BKE26030 ([gene|249DB77A83EE6D1EFDCB5C3D14A7801DD236294D|yqbO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTGGCTGTTAGTTTAGCCA, downstream forward: _UP4_ATTGGAACGAAGGGAGTCGT
  • BKK26030 ([gene|249DB77A83EE6D1EFDCB5C3D14A7801DD236294D|yqbO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTGGCTGTTAGTTTAGCCA, downstream forward: _UP4_ATTGGAACGAAGGGAGTCGT
  • References

  • 17218307