SubtiBank SubtiBank
ylxP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylxP

general stress protein, required for protection against paraquat stress
locus
BSU_16640
pI
7.89
mw
10.51 kDa
protein length
gene length
279 bp Sequence Blast
function
protection against paraquat stress
product
unknown
essential
no
synonyms
ymxD

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,736,156 1,736,434

    Expression and Regulation

    Operons

    genes
    [gene|9F6C447900410BF64409E5C41A11C76968DADAFA|ylxS]-[gene|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|nusA]-[gene|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]-[gene|7BFA65857F69855DBB3BB64D93B4ED2F09DC705B|rplGA]-[gene|378B77412D0DEA220A97DEC246410509D9B74D46|infB]-[gene|24835CE6CD2E1F183DB9121F29A63101718B5DF9|ylxP]-[gene|B3119A40393A288EF34FC3E9839B6E40AC6A6EA0|rbfA]
    description
    [Pubmed|8491709]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8491709], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA]: attenuation, [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA] stimulates termination [Reference|http://www.nature.com/articles/nmicrobiol20157], in [regulon|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA regulon]
  • regulation

  • autoregulation [SW|NusA] [http://www.nature.com/articles/nmicrobiol20157 reference]
  • induced by glucose [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B079 (ylxP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1078 NBRP B. subtilis, Japan]
  • BKE16640 ([gene|24835CE6CD2E1F183DB9121F29A63101718B5DF9|ylxP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCATTCACACTCCGCAAATC, downstream forward: _UP4_TGGTTTTAACTTAGAGGTGA
  • BKK16640 ([gene|24835CE6CD2E1F183DB9121F29A63101718B5DF9|ylxP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCATTCACACTCCGCAAATC, downstream forward: _UP4_TGGTTTTAACTTAGAGGTGA
  • References

  • 15805528,8491709,11948165,22582280