SubtiBank SubtiBank
ylxP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylxP

general stress protein, required for protection against paraquat stress
locus
BSU16640
pI
7.89
mw
10.51 kDa
protein length
gene length
279 bp Sequence Blast
function
protection against paraquat stress
product
unknown
essential
no
synonyms
ymxD

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,736,156 1,736,434

    Expression and Regulation

    Operons

    genes
    [gene|9F6C447900410BF64409E5C41A11C76968DADAFA|ylxS]-[gene|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|nusA]-[gene|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]-[gene|7BFA65857F69855DBB3BB64D93B4ED2F09DC705B|rplGA]-[gene|378B77412D0DEA220A97DEC246410509D9B74D46|infB]-[gene|24835CE6CD2E1F183DB9121F29A63101718B5DF9|ylxP]-[gene|B3119A40393A288EF34FC3E9839B6E40AC6A6EA0|rbfA]
    description
    [Pubmed|8491709]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8491709], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA]: attenuation, [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA] stimulates termination [Reference|http://www.nature.com/articles/nmicrobiol20157], in [regulon|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA regulon]
  • regulation

  • autoregulation [SW|NusA] [http://www.nature.com/articles/nmicrobiol20157 reference]
  • induced by glucose [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B079 (ylxP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1078 NBRP B. subtilis, Japan]
  • BKE16640 ([gene|24835CE6CD2E1F183DB9121F29A63101718B5DF9|ylxP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCATTCACACTCCGCAAATC, downstream forward: _UP4_TGGTTTTAACTTAGAGGTGA
  • BKK16640 ([gene|24835CE6CD2E1F183DB9121F29A63101718B5DF9|ylxP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCATTCACACTCCGCAAATC, downstream forward: _UP4_TGGTTTTAACTTAGAGGTGA
  • References

  • 15805528,8491709,11948165,22582280