SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


xylose isomerase
50.09 kDa
protein length
445 aa Sequence Blast
gene length
1338 bp Sequence Blast
utilization of xylan and xylose
xylose isomerase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of xylan/ xylose]
  • Gene

    1,891,908 1,893,245

    The protein

    Catalyzed reaction/ biological activity

  • D-xylose --> D-xylulose
  • Protein family

  • xylose isomerase family (according to Swiss-Prot)
  • Structure

  • [PDB|1A0D] (Geobacillus stearothermophilus)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2454911], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8132469], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR]: repression, [Pubmed|2454911], in [regulon|AF4395D134485290F4AA307B48494FED39E52CD7|XylR regulon]
  • regulation

  • carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8132469]
  • view in new tab

    Biological materials


  • GP1151 (del aphA3) available in [SW|Jörg Stülke]'s lab
  • 1A719 (no resistance), [Pubmed|1719948], available at [ BGSC]
  • BKE17600 ([gene|24829427B4518FE67038F194B54D4AAFAC64EF19|xylA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATTTCCCCCTTAAA, downstream forward: _UP4_TAACAGGATAAGCTCCAGAT
  • BKK17600 ([gene|24829427B4518FE67038F194B54D4AAFAC64EF19|xylA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATTTCCCCCTTAAA, downstream forward: _UP4_TAACAGGATAAGCTCCAGAT
  • References

  • 7966270,1921970,8132469,2454911,1588910,22900538