SubtiBank SubtiBank
yqeK [2018-12-03 15:02:07]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqeK [2018-12-03 15:02:07]

predicted HD superfamily hydrolase involved in NAD metabolism
21.14 kDa
protein length
186 aa Sequence Blast
gene length
558 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,643,215 → 2,643,775

    The protein


  • [PDB|3CCG] (the protein from ''Clostridium acetobutylicum'', 46% identity, 76% similarity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE25630 (Δ[gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTTCACGCATGCAAGTG, downstream forward: _UP4_AGCTGAACAGGAGGAATTTG
  • BKK25630 (Δ[gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTTCACGCATGCAAGTG, downstream forward: _UP4_AGCTGAACAGGAGGAATTTG
  • References

  • 15175311,22383849