SubtiBank SubtiBank
yqeK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqeK

predicted HD superfamily hydrolase involved in NAD metabolism
locus
BSU25630
pI
5.97
mw
21.14 kDa
protein length
186 aa Sequence Blast
gene length
561 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,643,215 2,643,775

    The protein

    [SW|Domains]

  • [SW|HD domain] (aa 14 ... 147) (according to the Interpro database)
  • Structure

  • [PDB|3CCG] (the protein from ''Clostridium acetobutylicum'', 46% identity, 76% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|722FD63050EED803C859FFD61338C02D5BB4CC1C|yqeG]-[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]-[gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]-[gene|7774FC36BAEAD33EDD48CB77DA0B5E7E0EA38CA2|yqeI]-[gene|AA4BB1F5B58371D536A6BBA86F6ECB5E5BFB12A8|nadD]-[gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]-[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|yqeL]-[gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE25630 ([gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTTCACGCATGCAAGTG, downstream forward: _UP4_AGCTGAACAGGAGGAATTTG
  • BKK25630 ([gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTTCACGCATGCAAGTG, downstream forward: _UP4_AGCTGAACAGGAGGAATTTG
  • References

  • 15175311,22383849