SubtiBank SubtiBank
rapC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rapC

response regulator aspartate phosphatase, controls [protein|search|ComA ]activity
locus
BSU_03770
pI
5.02
mw
45.47 kDa
protein length
382 aa Sequence Blast
gene length
1149 bp Sequence Blast
function
control of [protein|search|ComA ]activity
product
response regulator aspartate phosphatase
essential
no
synonyms
yclL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.2|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    428,831 429,979

    The protein

    Catalyzed reaction/ biological activity

  • control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity [Pubmed|12950917]
  • Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • five [SW|TPR repeat|tetratricopeptide repeats] (according to UniProt)
  • Effectors of protein activity

  • binding of [protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|PhrC] to [protein|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|RapC] prevents it from binding [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] [Pubmed|12950917]
  • Structure

  • [PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF], 57% identity) [pubmed|23526880]
  • Expression and Regulation

    Operons

    genes
    [gene|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC]-[gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]
    description
    [Pubmed|10464187]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10464187], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|10464187], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|10464187], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C065 (rapC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2063 NBRP B. subtilis, Japan]
  • BKE03770 ([gene|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCACCCTCTCCCA, downstream forward: _UP4_CAAATACAAAGGAGTGAAGG
  • BKK03770 ([gene|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCACCCTCTCCCA, downstream forward: _UP4_CAAATACAAAGGAGTGAAGG
  • References

  • 12950917,16091051,10464187,26582911,23526880