SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


putative toxin
3.00 kDa
protein length
gene length

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    430,185 430,274

    The protein

    Protein family

  • [SW|SscA family] (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE03788 ([gene|2420C171CBDDC4EC695759EBD2D20CB151C3F73D|yczM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTGCACCTCCTTGC, downstream forward: _UP4_TAAATAAACGTAATCTCCAT
  • BKK03788 ([gene|2420C171CBDDC4EC695759EBD2D20CB151C3F73D|yczM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTGCACCTCCTTGC, downstream forward: _UP4_TAAATAAACGTAATCTCCAT
  • References

  • 20156992