SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative toxin
3.00 kDa
protein length
gene length

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    430,185 430,274

    The protein

    Protein family

  • [SW|SscA family] (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE03788 ([gene|2420C171CBDDC4EC695759EBD2D20CB151C3F73D|yczM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTGCACCTCCTTGC, downstream forward: _UP4_TAAATAAACGTAATCTCCAT
  • BKK03788 ([gene|2420C171CBDDC4EC695759EBD2D20CB151C3F73D|yczM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTGCACCTCCTTGC, downstream forward: _UP4_TAAATAAACGTAATCTCCAT
  • References

  • 20156992