SubtiBank SubtiBank
ypqP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ypqP

C-terminal part of the split gene spsM (together with [gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]), legionaminic acid synthesis, in B. subtilis 168 the gene is disrupted by the [category|SW 5.1.2|SP-beta prophage]
locus
BSU_21670
pI
0.00
mw
0.00 kDa
protein length
202 aa Sequence Blast
gene length
606 bp Sequence Blast
function
legionaminic acid synthesis
product
UDP-NAcGlcA inverting 4,6-dehydratase (C-terminal part)
essential
no
synonyms
spsM

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.8|Biosynthesis of legionaminic acid (for spore crust))]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,286,448 → 2,287,053

    Phenotypes of a mutant

  • the [gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP] mutant of PY79 has a less hydrophobic spore surface [pubmed|32817102]
  • The protein

    Catalyzed reaction/ biological activity

  • SpsM catalyzes the C-4/C-6 dehydration of the UDP-GlcNAc to produce UDP-4-keto-6-deoxy-GlcNAc, this is the first reaction of the legionaminic acid biosynthesis pathway [pubmed|32817102]
  • required for spore crust assembly, legionaminic acid synthesis [pubmed|32817102]
  • Paralogous protein(s)

  • [protein|5DB168A3D087AAEB003D7548A1A4356ABD07F712|EpsC]:
  • [SW|Domains]

  • SpsM: Polysacc_synt_2 domain (Pfam accession number, PF02719) in the 18–296-aa region [Pubmed|25299644]
  • Structure

  • [PDB|6BWC] (from B. thuringiensis, 39% identity) [pubmed|29266550]
  • Expression and Regulation

    Operons

    genes
    [gene|6CBEACD5C9C88319C4F9BE4C53F5C6534EF9135F|sprA]-[gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]

    description

  • [pubmed|22383849]
  • sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    genes
    [gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A061 (ypqP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/61 NBRP B. subtilis, Japan]
  • BKE21670 (Δ[gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGATACAGCTTTATCTGTTT, downstream forward: _UP4_TAAAAACAAGCCTGTCTATC
  • BKK21670 (Δ[gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGATACAGCTTTATCTGTTT, downstream forward: _UP4_TAAAAACAAGCCTGTCTATC
  • References

  • 25299644,25326298,28535266,29266550,32817102