SubtiBank SubtiBank
prkC [2019-02-24 18:02:56]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

prkC [2019-02-24 18:02:56]

protein kinase C, induces [category|SW 4.2.4|Germination] of spores in response to DAP-type, and not to Lys-type cell wall muropeptides, stimulates [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR] activity
71.69 kDa
protein length
648 aa Sequence Blast
gene length
1947 bp Sequence Blast
germination in response to muropeptides
protein kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    1,651,142 1,653,088

    Phenotypes of a mutant

  • unable to germinate in response to muropeptides [Pubmed|18984160]
  • reduced growth at high salt [Pubmed|25845974]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP a protein = ADP a phosphoprotein (according to Swiss-Prot)
  • phosphorylation of [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR] on Thr-101 to stimulate its activity [Pubmed|26102633]
  • Protein family

  • [SW|protein kinase superfamily] (according to UniProt)
  • [SW|Domains]

  • contains three C-terminal [SW|PASTA domain]s (aa 356-424, 425-492, 493-559) (binds muropeptides) [Pubmed|18984160]
  • Modification

  • phosphorylation on Thr-290 [Pubmed|17218307], autophosphorylation on multiple threonine residues [Pubmed|12842463,20389117]
  • Effectors of protein activity

  • activated by muropeptides [Pubmed|18984160]
  • [protein|C22F7704DC9D36D96FE089ADCEA546D7A3FB3739|GpsB], [protein|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|DivIVA], and [protein|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|EzrA] are required for stimulation of [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] activity [Pubmed|25845974]
  • Structure

  • [PDB|4EQM] (intracellular domain of the ''Staphylococcus aureus'' enzyme, 51% identity) [Pubmed|22701750]
  • [PDB|3PY9] (entire extra-cellular region of PrkC from ''Staphylococcus aureus'') [Pubmed|21208192]
  • [PDB|4X3F] (intracellular domain of the ''Mycobacterium tuberculosis'' enzyme, 36% identity, 68% similarity) [Pubmed|25586004]
  • [SW|Localization]

  • inner spore membrane [Pubmed|18984160]
  • membrane [Pubmed|12406230]
  • division septum [Pubmed|25845974]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B134 (yloP::erm), available at the [ NBRP B. subtilis, Japan]
  • GP576 (spc), OMG302 (aphA3), available in [SW|Jörg Stülke]'s lab
  • 1A820 ( ''prkC''::''erm''), [Pubmed|12682299], available at [ BGSC]
  • 1A963 (no resistance), [Pubmed|12399479], available at [ BGSC]
  • 1A964 (no resistance), [Pubmed|12399479], available at [ BGSC]
  • BKE15770 ([gene|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAGCACTGATCTTCACC, downstream forward: _UP4_GATGAATAACAAGGAGGGAA
  • BKK15770 ([gene|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAGCACTGATCTTCACC, downstream forward: _UP4_GATGAATAACAAGGAGGGAA
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP832, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification of the kinase domain from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP849, available in [SW|Jörg Stülke]'s lab
  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1001, available in [SW|Jörg Stülke]'s lab
  • for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP825, available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
  • lacZ fusion

  • pGP829 (in [protein|search|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References


  • 20972452,21372323,26429880,27148245
  • Phosphorylation of PrkC

  • 12842463,20563625
  • Targets of PrkC-dependent phosphorylation

  • 19246764,20070526,20389117,24390483,24731262,25012659,25278935,25845974,26102633,30478337
  • Phsiological role of PrkC

  • 12399479,12406230,19246764,12842463,18984160,26102633
  • Expression/ localization of PrkC

  • 16025310,24752279,26731423,29374241
  • Structure/ biochemistry of PrkC

  • 21208192,22111897,23793375,25668224,25586004,22701750