SubtiBank SubtiBank
prkC
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

prkC

protein kinase C, induces germination of spores in response to DAP-type, and not to Lys-type cell wall muropeptides, stimulates WalR activity
locus
BSU15770
pI
4.83
mw
71.69 kDa
protein length
648 aa Sequence Blast
gene length
1944 bp Sequence Blast
function
germination in response to muropeptides
product
protein kinase
essential
no
ec
2.7.11.1
synonyms
yloP

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    1,651,142 → 1,653,088

    Phenotypes of a mutant

  • unable to germinate in response to muropeptides [Pubmed|18984160]
  • reduced growth at high salt [Pubmed|25845974]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP a protein = ADP a phosphoprotein (according to Swiss-Prot)
  • phosphorylation of [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR] on Thr-101 to stimulate its activity [Pubmed|26102633]
  • Protein family

  • [SW|protein kinase] domain (according to Swiss-Prot)
  • [SW|Domains]

  • contains three C-terminal [SW|PASTA domain]s (aa 356-424, 425-492, 493-559) (binds muropeptides) [Pubmed|18984160]
  • Modification

  • phosphorylation on Thr-290 [Pubmed|17218307], autophosphorylation on multiple threonine residues [Pubmed|12842463,20389117]
  • Effectors of protein activity

  • activated by muropeptides [Pubmed|18984160]
  • [protein|C22F7704DC9D36D96FE089ADCEA546D7A3FB3739|GpsB], [protein|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|DivIVA], and [protein|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|EzrA] are required for stimulation of [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] activity [Pubmed|25845974]
  • Structure

  • [PDB|4EQM] (intracellular domain of the ''Staphylococcus aureus'' enzyme, 51% identity) [Pubmed|22701750]
  • [PDB|3PY9] (entire extra-cellular region of PrkC from ''Staphylococcus aureus'') [Pubmed|21208192]
  • [PDB|4X3F] (intracellular domain of the ''Mycobacterium tuberculosis'' enzyme, 36% identity, 68% similarity) [Pubmed|25586004]
  • [SW|Localization]

  • inner spore membrane [Pubmed|18984160]
  • membrane [Pubmed|12406230]
  • division septum [Pubmed|25845974]
  • Expression and Regulation

    Operons

    genes
    [gene|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC]-[gene|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC]-[gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]
    description
    [Pubmed|16025310]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B134 (yloP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1133 NBRP B. subtilis, Japan]
  • GP576 (spc), OMG302 (aphA3), available in [SW|Stülke] lab
  • 1A820 ( ''prkC''::''erm''), [Pubmed|12682299], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A820&Search=1A820 BGSC]
  • 1A963 (no resistance), [Pubmed|12399479], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A963&Search=1A963 BGSC]
  • 1A964 (no resistance), [Pubmed|12399479], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A964&Search=1A964 BGSC]
  • BKE15770 (Δ[gene|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAGCACTGATCTTCACC, downstream forward: _UP4_GATGAATAACAAGGAGGGAA
  • BKK15770 (Δ[gene|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAGCACTGATCTTCACC, downstream forward: _UP4_GATGAATAACAAGGAGGGAA
  • Expression vector

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP832, available in [SW|Stülke] lab
  • for expression/ purification of the kinase domain from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP849, available in [SW|Stülke] lab
  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1001, available in [SW|Stülke] lab
  • for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP825, available in [SW|Stülke] lab, [pubmed|20389117]
  • lacZ fusion

  • pGP829 (in [protein|search|pAC7]), available in [SW|Stülke] lab
  • References

    Reviews

  • 20972452,21372323,26429880,27148245
  • Phosphorylation of PrkC

  • 12842463,20563625
  • Targets of PrkC-dependent phosphorylation

  • 19246764,20070526,20389117,24390483,24731262,25012659,25278935,25845974,26102633
  • Phsiological role of PrkC

  • 12399479,12406230,19246764,12842463,18984160,26102633
  • Expression/ localization of PrkC

  • 16025310,24752279,26731423
  • Structure/ biochemistry of PrkC

  • 21208192,22111897,23793375,25668224,25586004,22701750