SubtiBank SubtiBank
metE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

metE

methionine synthase
locus
BSU_13180
pI
4.84
mw
86.64 kDa
protein length
762 aa Sequence Blast
gene length
2289 bp Sequence Blast
function
biosynthesis of methionine
product
methionine synthase
essential
no
ec
2.1.1.14
synonyms
metC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.10|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    1,383,320 1,385,608

    The protein

    Catalyzed reaction/ biological activity

  • 5-methyltetrahydropteroyltri-L-glutamate + L-homocysteine --> L-methionine + tetrahydropteroyltri-L-glutamate (according to UniProt)
  • Protein family

  • vitamin-B12 independent methionine synthase family (single member, according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|17726680], S-cysteinylation after diamide stress (C719) [Pubmed|17611193]
  • Cys719 and Cys730 are S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|21749987] [Pubmed|22938038]
  • MetE is generally most strongly S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|21749987] [Pubmed|22938038]
  • Structure

  • [PDB|1T7L] (from ''Thermotoga maritima'', 44% identity, 61% similarity) [Pubmed|15630480]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|metE]

    regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • 1A607 ( ''metE''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A607&Search=1A607 BGSC]
  • BKE13180 ([gene|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|metE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTCTCCTCCTTTAT, downstream forward: _UP4_TAATTTGAAAAAACCATCTG
  • BKK13180 ([gene|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|metE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTCTCCTCCTTTAT, downstream forward: _UP4_TAATTTGAAAAAACCATCTG
  • References

    Reviews

  • 25852656
  • Original Publications

  • 21749987,22938038,21749987,19258532,16194229,10094622,17611193,18039762,17726680,12107147,24313874,24163341,15378759,29794222