SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


methionine synthase
86.64 kDa
protein length
762 aa Sequence Blast
gene length
2289 bp Sequence Blast
biosynthesis of methionine
methionine synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    1,383,320 1,385,608

    The protein

    Catalyzed reaction/ biological activity

  • 5-methyltetrahydropteroyltri-L-glutamate L-homocysteine = tetrahydropteroyltri-L-glutamate L-methionine (according to Swiss-Prot)
  • Protein family

  • vitamin-B12 independent methionine synthase family (according to Swiss-Prot)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|17726680], S-cysteinylation after diamide stress (C719) [Pubmed|17611193]
  • Cys719 and Cys730 are S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|21749987] [Pubmed|22938038]
  • MetE is generally most strongly S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|21749987] [Pubmed|22938038]
  • Structure

  • [PDB|1T7L] (from ''Thermotoga maritima'', 44% identity, 61% similarity) [Pubmed|15630480]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • 1A607 ( ''metE''::''erm''), [Pubmed|3015878], available at [ BGSC]
  • BKE13180 ([gene|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|metE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTCTCCTCCTTTAT, downstream forward: _UP4_TAATTTGAAAAAACCATCTG
  • BKK13180 ([gene|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|metE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTCTCCTCCTTTAT, downstream forward: _UP4_TAATTTGAAAAAACCATCTG
  • References


  • 25852656
  • Original Publications

  • 21749987,22938038,21749987,19258532,16194229,10094622,17611193,18039762,17726680,12107147,24313874,24163341,15378759,29794222