SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component response regulator
24.10 kDa
protein length
218 aa Sequence Blast
gene length
657 bp Sequence Blast
two-component response regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    3,994,369 3,995,025

    The protein

    Paralogous protein(s)

  • [protein|387EF370CE24F7A3C20789A57329A02EBED46F53|LnrK], [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR], [protein|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|YhcZ], [protein|EFEAF09E4449A022A7323450FDED9458426A0080|YdfI]
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 7-123) (according to UniProt)
  • [SW|HTH luxR-type domain] (aa 150-215) (according to UniProt)
  • Modification

  • phosphorylation by [protein|6D10C9232F0D28973F7C3C6ECDFD6948928CB23F|YxjM]
  • Structure

  • [PDB|5HEV] ([protein|search|LiaR ]from Enterococcus faecium, 41% identity) [pubmed|27670715]
  • Biological materials


  • MGNA-B805 (yxjL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38910 ([gene|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|yxjL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATCGGCAAGCGCTACGC, downstream forward: _UP4_TAGAAATCTCTCATCCCGCC
  • BKK38910 ([gene|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|yxjL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATCGGCAAGCGCTACGC, downstream forward: _UP4_TAGAAATCTCTCATCCCGCC
  • References

  • 10094672,27670715