SubtiBank SubtiBank
yueE [2018-12-03 15:03:27]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yueE [2018-12-03 15:03:27]

19.88 kDa
protein length
176 aa Sequence Blast
gene length
528 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,264,678 → 3,265,208

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A647 (yueE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE31830 (Δ[gene|2387CF47A2E16C57D4CCA0B54282EF54CE4EBFE8|yueE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAAACCCCTCCTTTAG, downstream forward: _UP4_TAAGTACGGAACAGCGCCAG
  • BKK31830 (Δ[gene|2387CF47A2E16C57D4CCA0B54282EF54CE4EBFE8|yueE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAAACCCCTCCTTTAG, downstream forward: _UP4_TAAGTACGGAACAGCGCCAG
  • References

  • 12850135