SubtiBank SubtiBank
yueE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yueE

putative metal-dependent phosphohydrolase
locus
BSU31830
pI
7.46
mw
19.88 kDa
protein length
176 aa Sequence Blast
gene length
531 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,264,678 3,265,208

    The protein

    [SW|Domains]

  • [SW|HD domain] (aa 19 ... 149) (according to the Interpro database)
  • Expression and Regulation

    Operons

    genes
    [gene|2387CF47A2E16C57D4CCA0B54282EF54CE4EBFE8|yueE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A647 (yueE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/647 NBRP B. subtilis, Japan]
  • BKE31830 ([gene|2387CF47A2E16C57D4CCA0B54282EF54CE4EBFE8|yueE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAAACCCCTCCTTTAG, downstream forward: _UP4_TAAGTACGGAACAGCGCCAG
  • BKK31830 ([gene|2387CF47A2E16C57D4CCA0B54282EF54CE4EBFE8|yueE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAAACCCCTCCTTTAG, downstream forward: _UP4_TAAGTACGGAACAGCGCCAG
  • References

  • 12850135