SubtiBank SubtiBank
yueE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yueE

putative metal-dependent phosphohydrolase
locus
BSU_31830
pI
7.46
mw
19.88 kDa
protein length
176 aa Sequence Blast
gene length
531 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,264,678 3,265,208

    The protein

    [SW|Domains]

  • [SW|HD domain] (aa 23-139) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|2387CF47A2E16C57D4CCA0B54282EF54CE4EBFE8|yueE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A647 (yueE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/647 NBRP B. subtilis, Japan]
  • BKE31830 ([gene|2387CF47A2E16C57D4CCA0B54282EF54CE4EBFE8|yueE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAAACCCCTCCTTTAG, downstream forward: _UP4_TAAGTACGGAACAGCGCCAG
  • BKK31830 ([gene|2387CF47A2E16C57D4CCA0B54282EF54CE4EBFE8|yueE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAAACCCCTCCTTTAG, downstream forward: _UP4_TAAGTACGGAACAGCGCCAG
  • References

  • 12850135