SubtiBank SubtiBank
yxeH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxeH

[SW|HAD superfamily] sugar phosphatase
locus
BSU_39550
pI
4.64
mw
30.07 kDa
protein length
270 aa Sequence Blast
gene length
813 bp Sequence Blast
function
dephosphorylation of phosphosugars
product
sugar phosphatase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    4,063,684 4,064,496

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of alpha-glucose-1-P and erythrose-4-P [pubmed|16990279]
  • Protein family

  • [SW|HAD superfamily] (according to UniProt)
  • [SW|Cof family] (according to UniProt)
  • Structure

  • [PDB|1RKQ] (YidA from E. coli, 51% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|637445F04D3F96D83DE46070CD6958A27EEB45DD|yxeF]-[gene|1C19EAEA89E95440204186A2644DDE89CF9F597F|yxeG]-[gene|23868F99A31FC20E9CB5FB2B6DBCF182C63D2335|yxeH]
    description
    [Pubmed|10746760]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B707 (yxeH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1706 NBRP B. subtilis, Japan]
  • BKE39550 ([gene|23868F99A31FC20E9CB5FB2B6DBCF182C63D2335|yxeH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGCATCTCCTTCATG, downstream forward: _UP4_TAATAAAAAATCCAGCCTTC
  • BKK39550 ([gene|23868F99A31FC20E9CB5FB2B6DBCF182C63D2335|yxeH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGCATCTCCTTCATG, downstream forward: _UP4_TAATAAAAAATCCAGCCTTC
  • References

  • 16672620,25527541,16990279