SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|HAD superfamily] sugar phosphatase
30.07 kDa
protein length
270 aa Sequence Blast
gene length
813 bp Sequence Blast
dephosphorylation of phosphosugars
sugar phosphatase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    4,063,684 4,064,496

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of alpha-glucose-1-P and erythrose-4-P [pubmed|16990279]
  • Protein family

  • [SW|HAD superfamily] (according to UniProt)
  • [SW|Cof family] (according to UniProt)
  • Structure

  • [PDB|1RKQ] (YidA from E. coli, 51% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B707 (yxeH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39550 ([gene|23868F99A31FC20E9CB5FB2B6DBCF182C63D2335|yxeH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGCATCTCCTTCATG, downstream forward: _UP4_TAATAAAAAATCCAGCCTTC
  • BKK39550 ([gene|23868F99A31FC20E9CB5FB2B6DBCF182C63D2335|yxeH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGCATCTCCTTCATG, downstream forward: _UP4_TAATAAAAAATCCAGCCTTC
  • References

  • 16672620,25527541,16990279