SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


thiamine [SW|ECF transporter] (membrane-spanning T protein)
27.89 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
thiamine uptake
thiamine [SW|ECF transporter] (membrane-spanning T protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter] → [category|SW|Class I ECF transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of thiamine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,388,070 1,388,834

    The protein

    Protein family

  • cbiQ family (single member, according to UniProt)
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([protein|search|Thi-box]) [Pubmed|12376536]
  • view in new tab

    Biological materials


  • MGNA-B311 (ykoC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13210 ([gene|236095EDE02EC9EA7768D9D30CED2345D3B7A1A9|thiX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACCGCCGCCGCTTTCACAG, downstream forward: _UP4_TAAAAAATCCGCTATCACAG
  • BKK13210 ([gene|236095EDE02EC9EA7768D9D30CED2345D3B7A1A9|thiX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACCGCCGCCGCTTTCACAG, downstream forward: _UP4_TAAAAAATCCGCTATCACAG
  • References

  • 10092453,16291685,12376536,18763711