SubtiBank SubtiBank
yydC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yydC

unknown
locus
BSU_40210
pI
5.29
mw
15.35 kDa
protein length
132 aa Sequence Blast
gene length
399 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,132,338 4,132,736

    Expression and Regulation

    Operons

    genes
    [gene|660FD9F2AC911E4E70E242F14A2EA6A208F25E28|yyzF]-[gene|AC2A9DC3DA569231442582A95EDB2A98BA335184|yydA]-[gene|F30AA652362B7459D479345AB373D19FA1EAFBBF|yydB]-[gene|235399FB29FA7443D41AA9543EEB18F195503091|yydC]-[gene|1470E1E1BAE5EA5BA9831E2BCEF9B61E79450510|yydD]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|235399FB29FA7443D41AA9543EEB18F195503091|yydC]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE40210 ([gene|235399FB29FA7443D41AA9543EEB18F195503091|yydC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATCAATCATTCTTAACACT, downstream forward: _UP4_ATGATTAGCAGAACGGAGAG
  • BKK40210 ([gene|235399FB29FA7443D41AA9543EEB18F195503091|yydC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATCAATCATTCTTAACACT, downstream forward: _UP4_ATGATTAGCAGAACGGAGAG
  • References

  • 26577401