SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


7.39 kDa
protein length
gene length
204 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,388,610 2,388,813

    Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • BKE22820 ([gene|231FFD626594226B2A46BEE70C851468DA861795|yphE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGACGTGCGCCTCCCCG, downstream forward: _UP4_TAAAGCTGTAAAAGGAAGTG
  • BKK22820 ([gene|231FFD626594226B2A46BEE70C851468DA861795|yphE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGACGTGCGCCTCCCCG, downstream forward: _UP4_TAAAGCTGTAAAAGGAAGTG
  • References

  • 20817675