SubtiBank SubtiBank
ypiF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypiF

unknown
locus
BSU_22570
pI
5.09
mw
17.12 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,365,235 2,365,681

    The protein

    Modification

  • phosphorylated on Arg-4 (phosphorylation serves as tag for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]) [Pubmed|27749819]
  • Expression and Regulation

    Operons

    genes
    [gene|230FA5701AE56753780E80E204C6A588ED7BC36B|ypiF]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A505 (ypiF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/505 NBRP B. subtilis, Japan]
  • BKE22570 ([gene|230FA5701AE56753780E80E204C6A588ED7BC36B|ypiF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCTCCCCCTTTACG, downstream forward: _UP4_TAAAAACACTTACATTTCCT
  • BKK22570 ([gene|230FA5701AE56753780E80E204C6A588ED7BC36B|ypiF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCTCCCCCTTTACG, downstream forward: _UP4_TAAAAACACTTACATTTCCT
  • References

  • 12850135,12850135,27749819