SubtiBank SubtiBank
ypiF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypiF

unknown
locus
BSU22570
pI
5.09
mw
17.12 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,365,235 2,365,681

    The protein

    Modification

  • phosphorylated on Arg-4 (phosphorylation serves as tag for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]) [Pubmed|27749819]
  • Expression and Regulation

    Operons

    genes
    [gene|230FA5701AE56753780E80E204C6A588ED7BC36B|ypiF]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A505 (ypiF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/505 NBRP B. subtilis, Japan]
  • BKE22570 ([gene|230FA5701AE56753780E80E204C6A588ED7BC36B|ypiF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCTCCCCCTTTACG, downstream forward: _UP4_TAAAAACACTTACATTTCCT
  • BKK22570 ([gene|230FA5701AE56753780E80E204C6A588ED7BC36B|ypiF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCTCCCCCTTTACG, downstream forward: _UP4_TAAAAACACTTACATTTCCT
  • References

  • 12850135,12850135,27749819