SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to multidrug-efflux transporter
12.82 kDa
protein length
119 aa Sequence Blast
gene length
360 bp Sequence Blast
subunit of unidentified multidrug transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Multidrug exporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,448,693 3,449,052

    The protein

    Protein family

  • paired small multidrug resistance protein family ([SW|PSMR family]) [Pubmed|17942072]
  • [SW|drug/metabolite transporter (DMT) superfamily] (according to UniProt)
  • [SW|Small multidrug resistance (SMR) (TC 2.A.7.1) family] (according to UniProt)
  • Structure

  • [PDB|3B5D] (from E. coli, 44% identity) [pubmed|18024586]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A502 (yvaE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33570 ([gene|230D790937DAFB82A04B8597699115E1C1EAE98E|yvaE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCCAAGCATAGAAACACCC, downstream forward: _UP4_GTACATAAAAGCGGGCAGTA
  • BKK33570 ([gene|230D790937DAFB82A04B8597699115E1C1EAE98E|yvaE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCCAAGCATAGAAACACCC, downstream forward: _UP4_GTACATAAAAGCGGGCAGTA
  • References


  • 17942072
  • Original publications

  • 21926231,18024586