SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


14.31 kDa
protein length
132 aa Sequence Blast
gene length
399 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    246,094 246,492

    Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|25666135], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    Biological materials


  • BKE02250 ([gene|22A5905A0C2A9303C166A5C2D784AF0B6541A311|ybfJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATATGGCTAGTTTGC, downstream forward: _UP4_TAGCAGTTTCCTTGATTTTA
  • BKK02250 ([gene|22A5905A0C2A9303C166A5C2D784AF0B6541A311|ybfJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATATGGCTAGTTTGC, downstream forward: _UP4_TAGCAGTTTCCTTGATTTTA
  • References

  • 12107147