SubtiBank SubtiBank
ybfJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybfJ

unknown
locus
BSU_02250
pI
5.64
mw
14.31 kDa
protein length
132 aa Sequence Blast
gene length
399 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    246,094 246,492

    Expression and Regulation

    Operons

    genes
    [gene|A39D349BBE13F4F3F6D33DA72CB8149A5170255C|mpr]-[gene|22A5905A0C2A9303C166A5C2D784AF0B6541A311|ybfJ]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|25666135], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    Biological materials

    Mutant

  • BKE02250 ([gene|22A5905A0C2A9303C166A5C2D784AF0B6541A311|ybfJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATATGGCTAGTTTGC, downstream forward: _UP4_TAGCAGTTTCCTTGATTTTA
  • BKK02250 ([gene|22A5905A0C2A9303C166A5C2D784AF0B6541A311|ybfJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATATGGCTAGTTTGC, downstream forward: _UP4_TAGCAGTTTCCTTGATTTTA
  • References

  • 12107147