SubtiBank SubtiBank
yfzA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfzA

unknown
locus
BSU_08029
pI
6.00
mw
11.00 kDa
protein length
gene length
267 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    875,428 875,694

    Biological materials

    Mutant

  • BKE08029 ([gene|226A5B142C460E1FAD35E18F063E93A4F18C2AB0|yfzA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08029 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAATTATCCATTTCCT, downstream forward: _UP4_TAAAGCAATAACTTCTGATG
  • BKK08029 ([gene|226A5B142C460E1FAD35E18F063E93A4F18C2AB0|yfzA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08029 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAATTATCCATTTCCT, downstream forward: _UP4_TAAAGCAATAACTTCTGATG